Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 723728
End position: 723751
Length: 24

DNA sequence
>NC_018936, from 723728 to 723751 (24 bp); Streptococcus pyogenes A20 ACAGCACCAGCAACAGTAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 723629-723805	Sequence	A20_0765c - hypothetical protein (Protein is coded in complementary strand; from 723805 to 723629)