Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1181009
End position: 1181035
Length: 27

DNA sequence
>NC_018936, from 1181009 to 1181035 (27 bp); Streptococcus pyogenes A20 ATCTTCTTCATCTTCTTCATTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1180413-1181354	Sequence	A20_1261c - LPXTG-motif cell wall anchor domain protein (Protein is coded in complementary strand; from 1181354 to 1180413)