Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1358913
End position: 1358939
Length: 27

DNA sequence
>NC_018936, from 1358913 to 1358939 (27 bp); Streptococcus pyogenes A20 TTTTCAAACTTTTCAAAGTTTTCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1358661-1359578	Sequence	A20_1433c glyQ glycyl-tRNA synthetase, alpha subunit (Protein is coded in complementary strand; from 1359578 to 1358661)