Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1594370
End position: 1594396
Length: 27

DNA sequence
>NC_018936, from 1594370 to 1594396 (27 bp); Streptococcus pyogenes A20 CTTTTTCCACCTTTTCCACTTATTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1593725-1595350	Sequence	A20_1680c - putative salivaricin A modification enzyme (Protein is coded in complementary strand; from 1595350 to 1593725)