Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1164329
End position: 1164358
Length: 30

DNA sequence
>NC_018936, from 1164329 to 1164358 (30 bp); Streptococcus pyogenes A20 ACTGTCATGCACTGTTATTCACTGTCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1164354-1164773	Sequence	A20_1232c - hypothetical protein (Protein is coded in complementary strand; from 1164773 to 1164354)