Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1568313
End position: 1568342
Length: 30

DNA sequence
>NC_018936, from 1568313 to 1568342 (30 bp); Streptococcus pyogenes A20 TTCTTCATCTTCTTCATCTTCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1568302-1568877	Sequence	A20_1657c rpoE putative DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 1568877 to 1568302)