Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 327829
End position: 327858
Length: 30

DNA sequence
>NC_018936, from 327829 to 327858 (30 bp); Streptococcus pyogenes A20 ATGGCAAATAAAGGCAAGTAATGGCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 327205-328143	Sequence	A20_0369c ftsD fecCD transport family protein (Protein is coded in complementary strand; from 328143 to 327205)