Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1675487
End position: 1675522
Length: 36

DNA sequence
>NC_018936, from 1675487 to 1675522 (36 bp); Streptococcus pyogenes A20 TTTTTCTGGTTTAGTTTCTGGTTTTTTATCTGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1675257-1678751	Sequence	A20_1761c scpA C5a peptidase (Protein is coded in complementary strand; from 1678751 to 1675257)