Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1681728
End position: 1681787
Length: 60

DNA sequence
>NC_018936, from 1681728 to 1681787 (60 bp); Streptococcus pyogenes A20 CCATCTCCAGACCAGTCATCTTCAGGCCAGTCATCTCCAGACCAGTCATCTCCAGACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1680969-1681910	Sequence	A20_1763c sic1.01 sic family protein (Protein is coded in complementary strand; from 1681910 to 1680969)