Sequence retrieval

Genome: Streptococcus dysgalactiae subsp. equisimilis AC-2713
Start position: 1599240
End position: 1599269
Length: 30

DNA sequence
>NC_019042, from 1599240 to 1599269 (30 bp); Streptococcus dysgalactiae subsp. equisimilis AC-2713 TAATAATTTTTGATAATCTTCAATACTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1598641-1599777	Sequence	SDSE_1682 int Tyrosine recombinase xerC (Protein is coded in complementary strand; from 1599777 to 1598641)