Sequence retrieval

Genome: Streptococcus dysgalactiae subsp. equisimilis AC-2713
Start position: 413690
End position: 413719
Length: 30

DNA sequence
>NC_019042, from 413690 to 413719 (30 bp); Streptococcus dysgalactiae subsp. equisimilis AC-2713 GTCTTTCCTTGGCTGTCCTTGTCTTTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 413282-414916	Sequence	SDSE_0455 - Virulence factor mviN homolog