Sequence retrieval

Genome: Streptococcus dysgalactiae subsp. equisimilis AC-2713
Start position: 1272602
End position: 1272637
Length: 36

DNA sequence
>NC_019042, from 1272602 to 1272637 (36 bp); Streptococcus dysgalactiae subsp. equisimilis AC-2713 TTTTTTCTTTGGTAGTTTCTTTGGTAGTTTCTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1272415-1273950	Sequence	SDSE_1342 - K03655 ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 1273950 to 1272415)