Sequence retrieval

Genome: Streptococcus dysgalactiae subsp. equisimilis AC-2713
Start position: 1353519
End position: 1353563
Length: 45

DNA sequence
>NC_019042, from 1353519 to 1353563 (45 bp); Streptococcus dysgalactiae subsp. equisimilis AC-2713 TTCAGCTTTCTTAGCGTCTTCTTTCTTAGCTTCTGGTTTTTTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1353409-1354980	Sequence	SDSE_1436 spg Immunoglobulin G-binding protein G (Protein is coded in complementary strand; from 1354980 to 1353409)