Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1251231
End position: 1251266
Length: 36

DNA sequence
>NC_019537, from 1251231 to 1251266 (36 bp); Francisella tularensis subsp. holarctica F92 TTTTATATAAATTTTTATATAAATACTTATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1250237-1251232	Sequence	F92_07300 - hypothetical protein (Protein is coded in complementary strand; from 1251232 to 1250237)