Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1386150
End position: 1386173
Length: 24

DNA sequence
>NC_019537, from 1386150 to 1386173 (24 bp); Francisella tularensis subsp. holarctica F92 TATTATTTTTATTATCATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1384235-1386181	Sequence	F92_08155 - ATP-dependent metallopeptidase family protein (Protein is coded in complementary strand; from 1386181 to 1384235)