Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1432025
End position: 1432051
Length: 27

DNA sequence
>NC_019537, from 1432025 to 1432051 (27 bp); Francisella tularensis subsp. holarctica F92 ATATTTTTTATATTCTTTATATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1431062-1432456	Sequence	F92_08365 - peptidase (Protein is coded in complementary strand; from 1432456 to 1431062)