Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1441408
End position: 1441443
Length: 36

DNA sequence
>NC_019537, from 1441408 to 1441443 (36 bp); Francisella tularensis subsp. holarctica F92 ATTATTATTTTGATCATTATTTTGATCATTGTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1441130-1443412	Sequence	F92_08425 - glycosyl hydrolase family protein (Protein is coded in complementary strand; from 1443412 to 1441130)