Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1599296
End position: 1599319
Length: 24

DNA sequence
>NC_019537, from 1599296 to 1599319 (24 bp); Francisella tularensis subsp. holarctica F92 TTGATATTAATATTGATCGTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1597196-1600309	Sequence	F92_09260 - RND transporter, hydrophobe/amphiphile efflux-1 (HAE1) family protein