Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1673577
End position: 1673606
Length: 30

DNA sequence
>NC_019537, from 1673577 to 1673606 (30 bp); Francisella tularensis subsp. holarctica F92 CAGCAGCAACAGCAACAGCTGCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1673330-1673707	Sequence	F92_09670 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1673707 to 1673330)