Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 168089
End position: 168115
Length: 27

DNA sequence
>NC_019537, from 168089 to 168115 (27 bp); Francisella tularensis subsp. holarctica F92 GCTGCAAAAGCTCCAAAAGCTGCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 168074-168235	Sequence	F92_00925 - metabolite:H+ symporter (MHS) family protein (Protein is coded in complementary strand; from 168235 to 168074)