Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1759330
End position: 1759359
Length: 30

DNA sequence
>NC_019537, from 1759330 to 1759359 (30 bp); Francisella tularensis subsp. holarctica F92 TAAAAAATCATGAATAATCATATAAAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1757414-1759333	Sequence	F92_10140 - IucA/IucC family siderophore biosynthesis protein
ORF... 1759340-1760602	Sequence	F92_10145 - major facilitator superfamily transporter