Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1798551
End position: 1798577
Length: 27

DNA sequence
>NC_019537, from 1798551 to 1798577 (27 bp); Francisella tularensis subsp. holarctica F92 TACCGCCATTACCACCATCACCGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1797677-1798681	Sequence	F92_10355 obgE GTPase CgtA (Protein is coded in complementary strand; from 1798681 to 1797677)