Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 1814778
End position: 1814825
Length: 48

DNA sequence
>NC_019537, from 1814778 to 1814825 (48 bp); Francisella tularensis subsp. holarctica F92 AAAGATATTTGTAGAAAAAGATATTTGTAGAAAAAGATATTTGTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1814574-1814879	Sequence	F92_10460 - 2-isopropylmalate synthase (Protein is coded in complementary strand; from 1814879 to 1814574)