Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 651276
End position: 651338
Length: 63

DNA sequence
>NC_019537, from 651276 to 651338 (63 bp); Francisella tularensis subsp. holarctica F92 GAAAGTTCACCAAAAGAGCAAGAAAGTTCACCAAAAGAGCAAGAAAGTTCACCAAAAGAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650134-651564	Sequence	F92_03650 - ATP-binding transcriptional regulator