Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 665182
End position: 665208
Length: 27

DNA sequence
>NC_019537, from 665182 to 665208 (27 bp); Francisella tularensis subsp. holarctica F92 GTAAAACTAGTATAACTATTAAAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 665136-666017	Sequence	F92_03715 - polyamine ABC transporter permease (Protein is coded in complementary strand; from 666017 to 665136)