Sequence retrieval

Genome: Francisella tularensis subsp. holarctica F92
Start position: 836410
End position: 836439
Length: 30

DNA sequence
>NC_019537, from 836410 to 836439 (30 bp); Francisella tularensis subsp. holarctica F92 ATAATGCTATGTAATGATATATAATGTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 836437-837309	Sequence	F92_04730 - 1-aminocyclopropane-1-carboxylate deaminase (Protein is coded in complementary strand; from 837309 to 836437)