Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 2532906
End position: 2532929
Length: 24

DNA sequence
>NC_019670, from 2532906 to 2532929 (24 bp); Pseudomonas putida UW4 AGTGCTGGTGCTGGTGCTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2528007-2536664	Sequence	PputUW4_02168 - cyclic beta 1-2 glucan synthetase (Protein is coded in complementary strand; from 2536664 to 2528007)