Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 3644155
End position: 3644178
Length: 24

DNA sequence
>NC_019670, from 3644155 to 3644178 (24 bp); Pseudomonas putida UW4 ACCAGCAACAGCGCCAGCACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3643447-3644250	Sequence	PputUW4_03100 - hypothetical protein (Protein is coded in complementary strand; from 3644250 to 3643447)