Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 3789220
End position: 3789243
Length: 24

DNA sequence
>NC_019670, from 3789220 to 3789243 (24 bp); Pseudomonas putida UW4 GCACCAGCACCAGCAACAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3788904-3790310	Sequence	PputUW4_03238 - permease for cytosine/purines, uracil, thiamine, allantoin (Protein is coded in complementary strand; from 3790310 to 3788904)