Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 4003554
End position: 4003577
Length: 24

DNA sequence
>NC_019670, from 4003554 to 4003577 (24 bp); Pseudomonas putida UW4 CAGGTGCCGGTGCAGGTGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4002950-4005559	Sequence	PputUW4_03444 - LysM domain-containing protein (Protein is coded in complementary strand; from 4005559 to 4002950)