Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 4237052
End position: 4237075
Length: 24

DNA sequence
>NC_019670, from 4237052 to 4237075 (24 bp); Pseudomonas putida UW4 GGAGCTGGAACTGGAGCAGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4236590-4237621	Sequence	PputUW4_03646 ompF outer membrane porin F (Protein is coded in complementary strand; from 4237621 to 4236590)