Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 449360
End position: 449383
Length: 24

DNA sequence
>NC_019670, from 449360 to 449383 (24 bp); Pseudomonas putida UW4 TGCAGGTGCCGGTGCAGCTGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 448053-450008	Sequence	PputUW4_00394 aceF1 dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 450008 to 448053)