Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 1032747
End position: 1032782
Length: 36

DNA sequence
>NC_019670, from 1032747 to 1032782 (36 bp); Pseudomonas putida UW4 GGCGGTCAGGGTCGAGGTCAGGGTGGTGGTCATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1031908-1032780	Sequence	PputUW4_00873 - polyamine ABC transporter permease (Protein is coded in complementary strand; from 1032780 to 1031908)