Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 4469373
End position: 4469408
Length: 36

DNA sequence
>NC_019670, from 4469373 to 4469408 (36 bp); Pseudomonas putida UW4 CGGCTCGGGTTCAGGCTCAGGTTCCGGCTCGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4468705-4469502	Sequence	PputUW4_03876 fliH flagellar assembly protein H (Protein is coded in complementary strand; from 4469502 to 4468705)