Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 5821053
End position: 5821088
Length: 36

DNA sequence
>NC_019670, from 5821053 to 5821088 (36 bp); Pseudomonas putida UW4 CGCCACCTGCTCCGCCACCTGCACCGCCGCCTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5820994-5821455	Sequence	PputUW4_05100 chpC chemosensory protein ChpC (Protein is coded in complementary strand; from 5821455 to 5820994)