Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 5998045
End position: 5998080
Length: 36

DNA sequence
>NC_019670, from 5998045 to 5998080 (36 bp); Pseudomonas putida UW4 GGCAGCTGGTTTAGCAGCCGGTTTTGCCGCTGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5997629-5998729	Sequence	PputUW4_05268 - hypothetical protein (Protein is coded in complementary strand; from 5998729 to 5997629)