Sequence retrieval

Genome: Pseudomonas putida UW4
Start position: 3846097
End position: 3846141
Length: 45

DNA sequence
>NC_019670, from 3846097 to 3846141 (45 bp); Pseudomonas putida UW4 GGTAGTGGTGGTGGCGGCGGGGGTGGTGGCGGTAGTGGTGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3846002-3846583	Sequence	PputUW4_03299 - hypothetical protein (Protein is coded in complementary strand; from 3846583 to 3846002)