Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1007311
End position: 1007334
Length: 24

DNA sequence
>NC_019738, from 1007311 to 1007334 (24 bp); Microcoleus sp. PCC 7113 CCTCAGTCTCAGTCTCAGTCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1007154-1007492	Sequence	Mic7113_0879 - hypothetical protein (Protein is coded in complementary strand; from 1007492 to 1007154)