Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1037730
End position: 1037756
Length: 27

DNA sequence
>NC_019738, from 1037730 to 1037756 (27 bp); Microcoleus sp. PCC 7113 GGCGGACAAGGGGGACAAGGGGGACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1037038-1040268	Sequence	Mic7113_0901 - DNA/RNA helicase, superfamily II, SNF2 family