Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1068156
End position: 1068179
Length: 24

DNA sequence
>NC_019738, from 1068156 to 1068179 (24 bp); Microcoleus sp. PCC 7113 TTGCCATTACCATTACCATTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1068153-1070219	Sequence	Mic7113_0925 - translation elongation factor-like GTPase (Protein is coded in complementary strand; from 1070219 to 1068153)