Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1093085
End position: 1093108
Length: 24

DNA sequence
>NC_019738, from 1093085 to 1093108 (24 bp); Microcoleus sp. PCC 7113 GCGGGGGAGCTGGGGAGCTGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1092858-1093193	Sequence	Mic7113_0942 - hypothetical protein (Protein is coded in complementary strand; from 1093193 to 1092858)