Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1118052
End position: 1118093
Length: 42

DNA sequence
>NC_019738, from 1118052 to 1118093 (42 bp); Microcoleus sp. PCC 7113 TTACCCATTACCCATTACCCATTACCCATTACCCATTACCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1118088-1119785	Sequence	Mic7113_0966 - cytochrome c oxidase, subunit I (Protein is coded in complementary strand; from 1119785 to 1118088)