Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1232677
End position: 1232703
Length: 27

DNA sequence
>NC_019738, from 1232677 to 1232703 (27 bp); Microcoleus sp. PCC 7113 CTGAATCATCTGAATCATCTGAATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1232463-1233296	Sequence	Mic7113_1071 - hypothetical protein (Protein is coded in complementary strand; from 1233296 to 1232463)