Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1346440
End position: 1346463
Length: 24

DNA sequence
>NC_019738, from 1346440 to 1346463 (24 bp); Microcoleus sp. PCC 7113 TGCTCTTGCTGTTGGTCTTGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1344010-1346592	Sequence	Mic7113_1171 - replication restart DNA helicase PriA (Protein is coded in complementary strand; from 1346592 to 1344010)