Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1465686
End position: 1465709
Length: 24

DNA sequence
>NC_019738, from 1465686 to 1465709 (24 bp); Microcoleus sp. PCC 7113 TCTCCCCATCTCCCCATCTCCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1464575-1466395	Sequence	Mic7113_1272 - molybdate ABC transporter, permease protein (Protein is coded in complementary strand; from 1466395 to 1464575)