Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 1935000
End position: 1935023
Length: 24

DNA sequence
>NC_019738, from 1935000 to 1935023 (24 bp); Microcoleus sp. PCC 7113 CCGCGTCCCCGCGTCCCCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1934021-1935523	Sequence	Mic7113_1667 - serine/threonine protein kinase (Protein is coded in complementary strand; from 1935523 to 1934021)