Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2312756
End position: 2312779
Length: 24

DNA sequence
>NC_019738, from 2312756 to 2312779 (24 bp); Microcoleus sp. PCC 7113 GGCTTTGGCTTTGGGTTTGGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2312112-2313332	Sequence	Mic7113_1975 - arabinose efflux permease family protein (Protein is coded in complementary strand; from 2313332 to 2312112)