Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2338814
End position: 2338861
Length: 48

DNA sequence
>NC_019738, from 2338814 to 2338861 (48 bp); Microcoleus sp. PCC 7113 AAGTCATCATCAAAGTCATCATCAAAGTCGTCTTCAAAGTCATCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2338259-2339929	Sequence	Mic7113_2004 - hypothetical protein (Protein is coded in complementary strand; from 2339929 to 2338259)