Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2453986
End position: 2454027
Length: 42

DNA sequence
>NC_019738, from 2453986 to 2454027 (42 bp); Microcoleus sp. PCC 7113 ATTACCCATTACCCATTACCCATTACCCATTACCCATTACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2453682-2455082	Sequence	Mic7113_2148 - acyl-CoA synthetase (AMP-forming)/AMP-acid ligase II