Sequence retrieval

Genome: Microcoleus sp. PCC 7113
Start position: 2762155
End position: 2762178
Length: 24

DNA sequence
>NC_019738, from 2762155 to 2762178 (24 bp); Microcoleus sp. PCC 7113 GAGGAGGAGGGGGAGGCGGGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2760864-2762651	Sequence	Mic7113_2401 - TPR repeat-containing protein (Protein is coded in complementary strand; from 2762651 to 2760864)